Paste.InterGen.Online

Untitled

From Anonymous, 3 Days ago, written in Plain Text, viewed 6 times. This paste will expire in 3 Weeks.
URL https://paste.intergen.online/view/b10bde9a Embed
Download Paste or View Raw
  1. MCS: 6403..6444
  2. MCS sequence: GGAAGAGCCATGGGCGGCCGCGAATTCCTCGAGGGCTCTTCC
  3. In-frame codons from 6403: 6403:GGA 6406:AGA 6409:GCC 6412:ATG 6415:GGC 6418:GGC 6421:CGC 6424:GAA 6427:TTC 6430:CTC 6433:GAG 6436:GGC 6439:TCT 6442:TCC
  4. In-frame leucine codon(s): 6430-6432 (CTC)
  5. NEBcutter project id: pJT3YYYkWj3-9g1d3_pTWIN2
  6. NEB enzymes with empty dmsen (not methylation-sensitive) whose recognition span covers the in-frame leucine codon:
  7. enzyme  num_sites       recpos  recseq  recsite ct1     cb1     ct2     cb2
  8. BsoBI   3       6430    CYCGRG  C^TCGA_G        6430    6434    0       0
  9. MnlI    39      6429    CCTC    CCTC    6439    6438    0       0
  10. SmlI    8       6430    CTYRAG  C^TCGA_G        6430    6434    0       0
  11. Subset with a cleavage coordinate inside 6430-6432 (codon bases):
  12. enzyme  num_sites       ct1     cb1     ct2     cb2
  13. BsoBI   3       6430    6434    0       0
  14. SmlI    8       6430    6434    0       0
  15.  

Reply to "Untitled"

Here you can reply to the paste above

Powered by Stikked